Sequence ID | >WENV182570440 |
Genome ID | OJFC01007245 |
Search identical group | |
Phylum/Class | [OJFC] seawater metagenome; Sea water |
Species | |
Start position on genome | 1194 |
End posion on genome | 1119 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tgttgtagtg |
tRNA gene sequence |
GTGGGCGTAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTGGTCGTGGGTTCGAAC |
Downstream region at tRNA end position |
ttaccagtgg |
Secondary structure (Cloverleaf model) | >WENV182570440 His GTG g CCCA ttaccagtgg G - C T - A G - C G - C G + T C - G G - C C A T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A C TGGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |