Sequence ID | >WENV182570805 |
Genome ID | OJFF01001092 |
Search identical group | |
Phylum/Class | [OJFF] seawater metagenome; Sea water |
Species | |
Start position on genome | 377 |
End posion on genome | 305 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtataaaaat |
tRNA gene sequence |
GCCTCCTTAGCTCAGCGGCTAGAGCATCGTATTTGTAATGCGAGGGTCGTCGGTTCAATT |
Downstream region at tRNA end position |
tttttttatc |
Secondary structure (Cloverleaf model) | >WENV182570805 Thr TGT t Ttgt tttttttatc G - C C - G C - G T - A C - G C - G T - A T T T C A G C C A C G A A | | | | | A G C T C G G T C G G C G | | | | T T C G A G C T A A GGGTC T - A C - G G - C T + G A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |