Sequence ID | >WENV182572762 |
Genome ID | OJFM01012428 |
Search identical group | |
Phylum/Class | [OJFM] seawater metagenome; Sea water |
Species | |
Start position on genome | 830 |
End posion on genome | 754 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
taaacaccac |
tRNA gene sequence |
AGGGGTGTAGTTCGAATTGGTAGAACAGCGGTCTCCAAAACCGATGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
aattacaagt |
Secondary structure (Cloverleaf model) | >WENV182572762 Trp CCA c GCCA aattacaagt A - T G - C G - C G - C G - C T - A G - C T G T C T C C C A A A G A | + | | | G T C T T G G G G G G C T | | | | T T G G A A C G T A A TGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |