Sequence ID | >WENV182575995 |
Genome ID | OJFX01001220 |
Search identical group | |
Phylum/Class | [OJFX] seawater metagenome; Sea water |
Species | |
Start position on genome | 8481 |
End posion on genome | 8556 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgttggcagc |
tRNA gene sequence |
GGCCAGATAGCTCAGTTGGTAGAGCAGGGGATTGAAAATCCCCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
cactgctggg |
Secondary structure (Cloverleaf model) | >WENV182575995 Phe GAA c ACCA cactgctggg G - C G - C C - G C - G A - T G - C A - T T T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |