| Sequence ID | >WENV182576121 |
| Genome ID | OJFX01003475 |
| Phylum/Class | [OJFX] seawater metagenome; Sea water |
| Species | |
| Start position on genome | 2309 |
| End posion on genome | 2234 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
tttctagcac |
| tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACACTGCCCTTTCACGGCGGCGACAGGGGTTCGAAT |
| Downstream region at tRNA end position |
attatttagt |
| Secondary structure (Cloverleaf model) | >WENV182576121 Glu TTC
c GCCA attatttagt
G - C
T - A
C - G
C - G
C - G
C - G
A - T T A
T T C C C C A
A G A C | | | | | G
G T C T G A G G G G C
G + | | | T T
C G G A C
C T A A CGAC
C - G
T + G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |