Sequence ID | >WENV182576502 |
Genome ID | OJFX01041086 |
Search identical group | |
Phylum/Class | [OJFX] seawater metagenome; Sea water |
Species | |
Start position on genome | 460 |
End posion on genome | 385 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaagaacaat |
tRNA gene sequence |
TCCTCAATAGCTCAGTTGGTAGAGCAACGGACTGTTAATCCGTTTGTCCCTGGTTCAAGT |
Downstream region at tRNA end position |
cattaaagaa |
Secondary structure (Cloverleaf model) | >WENV182576502 Asn GTT t GCCA cattaaagaa T - A C - G C - G T - A C - G A - T A - T T G T G G A C C A T G A A | | | | | A T C T C G C C T G G C G | | | | T T G G A G C T A A TTGTC A - T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |