| Sequence ID | >WENV182578350 |
| Genome ID | OJGN01000859 |
| Phylum/Class | [OJGN] seawater metagenome; Sea water |
| Species | |
| Start position on genome | 617 |
| End posion on genome | 542 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
gttaatatgg |
| tRNA gene sequence |
GGCCCTGTAGCTCAGTTGGTAGAGCATCGGATTGAAAATCCGTGTGTCACTGGTTCGAGT |
| Downstream region at tRNA end position |
ccacctctct |
| Secondary structure (Cloverleaf model) | >WENV182578350 Phe GAA
g ACCA ccacctctct
G - C
G - C
C - G
C - G
C - G
T + G
G + T T G
T T G A C C A
T G A A | | | | | G
T C T C G A C T G G C
G | | | | T T
G G A G C
T A A GTGTC
T T
C - G
G - C
G - C
A - T
T A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |