Sequence ID | >WENV182578801 |
Genome ID | OJGP01003609 |
Search identical group | |
Phylum/Class | [OJGP] seawater metagenome; Sea water |
Species | |
Start position on genome | 109 |
End posion on genome | 185 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tacaatttga |
tRNA gene sequence |
AGGGGTATAGTTCCAATTGGTAGAACAGCGGTCTCCAAAACCGACGGTTGGGAGTTCGAA |
Downstream region at tRNA end position |
tattctaaag |
Secondary structure (Cloverleaf model) | >WENV182578801 Trp CCA a GCCA tattctaaag A - T G - C G - C G - C G - C T - A A C T A T C T C T C A A A C A | + | | | G T C T T G G G G A G C T | | | | T T G G A A C G T A A CGGTT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |