| Sequence ID | >WENV182580617 |
| Genome ID | OJGW01004956 |
| Phylum/Class | [OJGW] seawater metagenome; Sea water |
| Species | |
| Start position on genome | 1915 |
| End posion on genome | 1990 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
cttgggacaa |
| tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGTAGAGCGTCTCACTCGTAATGAGAAGGTCGAGAGTTCGATT |
| Downstream region at tRNA end position |
gtcaagcctg |
| Secondary structure (Cloverleaf model) | >WENV182580617 Thr CGT
a CCCA gtcaagcctg
G - C
C - G
C - G
G + T
C - G
C - G
T - A T T
T C T C T C A
T G A A | | | | | G
T C T C G G A G A G C
G | | | | T T
G G A G C
T A G AGGTC
T - A
C - G
T - A
C - G
A - T
C A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |