Sequence ID | >WENV182581427 |
Genome ID | OJGX01006215 |
Search identical group | |
Phylum/Class | [OJGX] seawater metagenome; Sea water |
Species | |
Start position on genome | 2068 |
End posion on genome | 2144 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
actggcaatt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCTTGGTAGCGCACTTGCATGGGGTGCAAGGGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
gattccctac |
Secondary structure (Cloverleaf model) | >WENV182581427 Pro GGG t ACCA gattccctac C - G G - C G - C G - C G + T C - G G - C T A T C A T C C A C G A A | | | | | A T C G C G G T A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |