Sequence ID | >WENV182586736 |
Genome ID | OJHK01003978 |
Search identical group | |
Phylum/Class | [OJHK] seawater metagenome; Sea water |
Species | |
Start position on genome | 942 |
End posion on genome | 1031 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gttcacctca |
tRNA gene sequence |
GGAGAGATGGCAGAGTGGTCGAATGCGTCTGACTCGAAATCAGATTTACCGGCAACGGTA |
Downstream region at tRNA end position |
tttttatttc |
Secondary structure (Cloverleaf model) | >WENV182586736 Ser CGA a GCCA tttttatttc G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TTTACCGGCAACGGTAAC T - A C - G T - A G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |