Sequence ID | >WENV182587499 |
Genome ID | OJHM01015300 |
Search identical group | |
Phylum/Class | [OJHM] seawater metagenome; Sea water |
Species | |
Start position on genome | 216 |
End posion on genome | 141 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cctccactga |
tRNA gene sequence |
TCCGGCATAGCTCAGTTGGTAGAGCAAATGACTGTTAATCATTGGGTCGCAGGTTCGAGT |
Downstream region at tRNA end position |
aaaaaccctg |
Secondary structure (Cloverleaf model) | >WENV182587499 Asn GTT a GCCA aaaaaccctg T - A C - G C - G G - C G - C C - G A - T T G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |