Sequence ID | >WENV182592877 |
Genome ID | OJIS01000359 |
Search identical group | |
Phylum/Class | [OJIS] seawater metagenome; Sea water |
Species | |
Start position on genome | 8324 |
End posion on genome | 8249 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ggcgcattgc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
acctatccca |
Secondary structure (Cloverleaf model) | >WENV182592877 Val TAC c ACCA acctatccca G - C G - C G - C T - A C - G G - C T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |