Sequence ID | >WENV182593233 |
Genome ID | OJIT01009886 |
Search identical group | |
Phylum/Class | [OJIT] seawater metagenome; Sea water |
Species | |
Start position on genome | 556 |
End posion on genome | 480 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ggccgttgat |
tRNA gene sequence |
CGGCGTGTGGCGCAGCTTGGTAGCGCACTTCGTTCGGGACGAAGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ttttcccgca |
Secondary structure (Cloverleaf model) | >WENV182593233 Pro CGG t ACCA ttttcccgca C - G G - C G - C C - G G - C T - A G - C T A T C G T C C A C G A G | | | | | G T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |