Sequence ID | >WENV182594032 |
Genome ID | OJIV01000094 |
Search identical group | |
Phylum/Class | [OJIV] seawater metagenome; Sea water |
Species | |
Start position on genome | 15985 |
End posion on genome | 16060 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccctgaaaaa |
tRNA gene sequence |
GGGTTATTAGCTCAGTTGGTTTAGAGCGCTGCCTTGACAGGGCAGAGGTCACCGGTTCGA |
Downstream region at tRNA end position |
ggaagagcct |
Secondary structure (Cloverleaf model) | >WENV182594032 Val GAC a ACaa ggaagagcct G - C G - C G - C T + G T - A A - T T - A T A T T G A C C A T T G A A | | | | G G C T C G A C C G G C G | | | | T T T G A G C T T A G AGGTC C - G T - A G - C C - G C - G T G T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |