Sequence ID | >WENV182597873 |
Genome ID | OJJC01003738 |
Search identical group | |
Phylum/Class | [OJJC] metagenome; faeces |
Species | |
Start position on genome | 325 |
End posion on genome | 398 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cttaccattT |
tRNA gene sequence |
GCCTCCTTAGCTTAGTGGTAGAGCGTTGCACTTGTAATGCAAAGGTCGCTAGTTCAATTC |
Downstream region at tRNA end position |
tttttctcgt |
Secondary structure (Cloverleaf model) | >WENV182597873 Thr TGT T AAat tttttctcgt G - C C - G C - G T T C - G C - G T - A T T T C G G T C A G A A | | + | | A T T T C G G C T A G C G + | | | T T G G A G C T A G AGGTC T - A T - A G - C C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |