Sequence ID | >W141258531 |
Genome ID | CBXG010000037 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Bacteroides xylanisolvens SD CC 1b [CBXG] |
Start position on genome | 343 |
End posion on genome | 269 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaataaggct |
tRNA gene sequence |
GGTTCCGTAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTGGGTCAAGCGTTCGAA |
Downstream region at tRNA end position |
agagaaatcg |
Secondary structure (Cloverleaf model) | >W141258531 Arg TCT t ACtt agagaaatcg G - C G + T T - A T - A C - G C - G G - C T A T T T C G C A C G A A | | | | | G T C T C G A A G C G C G | | | | T T G G A G C A T A A GGGTC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |