Sequence ID | >WENV182617366 |
Genome ID | OJKD01002297 |
Search identical group | |
Phylum/Class | [OJKD] metagenome; faeces |
Species | |
Start position on genome | 222 |
End posion on genome | 297 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taaaatgaac |
tRNA gene sequence |
GCTCACATAGCTCAGTAGGCAGAGCGTCGCCTTGGTAAGGCGGAGGTCGTCGGTTCAATC |
Downstream region at tRNA end position |
aataaaataa |
Secondary structure (Cloverleaf model) | >WENV182617366 Thr GGT c TCCA aataaaataa G - C C - G T - A C - G A - T C - G A - T C T T T A G C C A T G A A + | | | | A A C T C G G T C G G C G | | | | T T G G A G C C A G AGGTC T + G C - G G - C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |