Sequence ID | >WENV182618691 |
Genome ID | OJKF01012896 |
Search identical group | |
Phylum/Class | [OJKF] metagenome; faeces |
Species | |
Start position on genome | 131 |
End posion on genome | 55 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaaaaatat |
tRNA gene sequence |
GCGTTTTTAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTGGGCCAGGGGTTCGAA |
Downstream region at tRNA end position |
ttatcggggt |
Secondary structure (Cloverleaf model) | >WENV182618691 Arg TCT t ACCA ttatcggggt G - C C - G G - C T - A T - A T - A T - A T A T T T C C C A C G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |