Sequence ID | >WENV182624138 |
Genome ID | OJKO01000767 |
Search identical group | |
Phylum/Class | [OJKO] metagenome; faeces |
Species | |
Start position on genome | 7634 |
End posion on genome | 7559 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gtcaccatat |
tRNA gene sequence |
GGACGATTAGCTCAGCTGGGAGAGCGCCTGCCTTACAAGCAGGATGTCGGCAGTTCGATC |
Downstream region at tRNA end position |
aacctagaag |
Secondary structure (Cloverleaf model) | >WENV182624138 Val TAC t ACCA aacctagaag G - C G - C A - T C - G G - C A - T T - A C T T C T G T C A C G A A | + | | | G T C T C G G G C A G C G | | | | T T G G A G C G A G ATGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |