Sequence ID | >WENV182625459 |
Genome ID | OJKP01000334 |
Search identical group | |
Phylum/Class | [OJKP] metagenome; faeces |
Species | |
Start position on genome | 18389 |
End posion on genome | 18318 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tcgatttgct |
tRNA gene sequence |
TGTCCTATGGTGTAATGGTAGCACTACAGTTTTTGGTTCTGTCAGTGGTGGTTCGAATCC |
Downstream region at tRNA end position |
gtcataaata |
Secondary structure (Cloverleaf model) | >WENV182625459 Gln TTG t ACag gtcataaata T - A G - C T - A C - G C - G T + G A - T T A T C C G C C A A A G | | + | | G T T G T G G G T G G C G + | | | T T G G C A C T A T CAGT A - T C - G A - T G - C T T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |