Sequence ID | >W141260771 |
Genome ID | CCAK010000032 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Coxiella burnetii [CCAK] |
Start position on genome | 19743 |
End posion on genome | 19818 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtagccatac |
tRNA gene sequence |
GCTGGCGTAGCTCAGTCGGTAGAGCAGCTGATTTGTAATCAGCCGGTCGTAGGTTCGATT |
Downstream region at tRNA end position |
ttgatcaatg |
Secondary structure (Cloverleaf model) | >W141260771 Thr TGT c TTCA ttgatcaatg G - C C - G T - A G - C G - C C - G G - C T T T T A T C C A T G A A + | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A CGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |