Sequence ID | >WENV182629068 |
Genome ID | OJKR01002844 |
Search identical group | |
Phylum/Class | [OJKR] metagenome; surface |
Species | |
Start position on genome | 2243 |
End posion on genome | 2316 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tgcggaacat |
tRNA gene sequence |
GCGGATGTAGCTCAATGGTAGAGCCCCAGTCTTCCAAACTGGCTACGCGAGTTCGATTCT |
Downstream region at tRNA end position |
gaaggccccg |
Secondary structure (Cloverleaf model) | >WENV182629068 Gly TCC t TCCA gaaggccccg G - C C - G G - C G - C A - T T - A G - C T T T T G C T C A A A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A C CTAC C - G C - G A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |