Sequence ID | >WENV182629523 |
Genome ID | OJKS01027300 |
Search identical group | |
Phylum/Class | [OJKS] metagenome; surface |
Species | |
Start position on genome | 133 |
End posion on genome | 61 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gaaaatcttg |
tRNA gene sequence |
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT |
Downstream region at tRNA end position |
actttttttt |
Secondary structure (Cloverleaf model) | >WENV182629523 Arg ACG g Gaat actttttttt T - A T - A C - G C - G T + G C - G G - C T G T G G T C C A T A A G | | | | | G G C C C G C C A G G C G | | | T T T C G G C C A G AGATT T - A C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |