Sequence ID | >WENV182632903 |
Genome ID | OJKY01000004 |
Search identical group | |
Phylum/Class | [OJKY] metagenome; faeces |
Species | |
Start position on genome | 160854 |
End posion on genome | 160927 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tagagagaat |
tRNA gene sequence |
GGTGCCATAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCCCCGGTTCGATT |
Downstream region at tRNA end position |
aagaaacaag |
Secondary structure (Cloverleaf model) | >WENV182632903 Phe GAA t ACtt aagaaacaag G - C G - C T - A G + T C - G C - G A - T T T T G G T C C A T G A A | | | | G T C T C G C C C G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |