Sequence ID | >WENV182638084 |
Genome ID | OJLA01007185 |
Search identical group | |
Phylum/Class | [OJLA] metagenome; faeces |
Species | |
Start position on genome | 2137 |
End posion on genome | 2063 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
acactaaatg |
tRNA gene sequence |
GTGTCGGTAGTTCAATGGTAGAGCCCCAGATTGTGATTCTGGTTGTTGCGGGTTCGAGCC |
Downstream region at tRNA end position |
tcccctttcc |
Secondary structure (Cloverleaf model) | >WENV182638084 His GTG g CCCA tcccctttcc G - C T - A G - C T - A C - G G - C G - C C G T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | + | T T G G A G C T A C TTGTT C - G C - G A - T G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |