Sequence ID | >WENV182643705 |
Genome ID | OJLW01000586 |
Search identical group | |
Phylum/Class | [OJLW] metagenome; surface |
Species | |
Start position on genome | 15293 |
End posion on genome | 15366 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttcttagttg |
tRNA gene sequence |
GCCTCCATAGCTCAGTGGACAGAGCAGTCGGCTTCTACCCGATTGGTCGAGGGTTCGAAT |
Downstream region at tRNA end position |
aaatatcccg |
Secondary structure (Cloverleaf model) | >WENV182643705 Arg TCT g GCaa aaatatcccg G - C C - G C - G T + G C - G C - G A - T T A T C T T C C A T G A A | | + | | G G C T C G G A G G G C G | | | | T T A G A G C C A A TGGTC G + T T - A C - G G - C G - C C C T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |