| Sequence ID | >W141262911 |
| Genome ID | CCCS020000034 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus ferrivorans [CCCS] |
| Start position on genome | 33562 |
| End posion on genome | 33472 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
cgtcccctca |
| tRNA gene sequence |
GGAGAGGTGACCGAGCGGCCGAAGGTGCAGCACTGGAAATGCTGTGTACTCCAAAAGGGT |
| Downstream region at tRNA end position |
atcaccgtcc |
| Secondary structure (Cloverleaf model) | >W141262911 Ser GGA
a GCCA atcaccgtcc
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C A C C C A
C G A G | | | | | G
G G C C A G T G G G C
G | | | T T
C A G G T
C G A G TGTACTCCAAAAGGGTACC
C - G
A - T
G - C
C - G
A - T
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |