| Sequence ID | >W141262917 |
| Genome ID | CCCS020000035 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus ferrivorans [CCCS] |
| Start position on genome | 243262 |
| End posion on genome | 243178 |
| Amino Acid | Pseudo |
| Anticodon | GTA |
| Upstream region at tRNA start position |
ttcgattttt |
| tRNA gene sequence |
GGAGAGTGATGGATTTGGCAAACCCAGCAGACTGTAAATCTGCCGCCTCTGGCAGCGCGC |
| Downstream region at tRNA end position |
atttgatgca |
| Secondary structure (Cloverleaf model) | >W141262917 Pseudo GTA
t ACCA atttgatgca
G - C
G - C
A - T
G - C
A - T
G - C
T + G T T
G G T G C C A
T T T A | + | | | G
G A G G T C G C G G C
G | | T T
C A C C C
A A A CGCCTCTGGCAGCG
G - C
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |