Sequence ID | >WENV182651514 |
Genome ID | OJMH01002266 |
Search identical group | |
Phylum/Class | [OJMH] human gut metagenome; feces |
Species | |
Start position on genome | 8744 |
End posion on genome | 8818 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cgtatggatc |
tRNA gene sequence |
GGGCCCGTAGCTCAGCTGGTTAGAGCGCATCCCTGATAAGGATGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
gaaaaatgaa |
Secondary structure (Cloverleaf model) | >WENV182651514 Ile GAT c ACag gaaaaatgaa G - C G - C G - C C - G C - G C - G G - C T G T C C T C C A C G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |