Sequence ID | >WENV182659261 |
Genome ID | OJML01007550 |
Search identical group | |
Phylum/Class | [OJML] human gut metagenome; feces |
Species | |
Start position on genome | 3333 |
End posion on genome | 3243 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gttgacgcat |
tRNA gene sequence |
GGAGTGATACTCAAGAGGCTGAAGAGGACGGTTTGCTAAATCGTTAGAGGTCGTAAGGCC |
Downstream region at tRNA end position |
gattactgga |
Secondary structure (Cloverleaf model) | >WENV182659261 Ser GCT t GCCA gattactgga G - C G - C A - T G - C T - A G - C A - T T A T C T C T C A A G A A | | | | | G G A C T C G A G A G C G | | | T T C A G A G T G A G TAGAGGTCGTAAGGCCTGC A - T C - G G - C G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |