Sequence ID | >WENV182662380 |
Genome ID | OJMN01037204 |
Search identical group | |
Phylum/Class | [OJMN] human gut metagenome; feces |
Species | |
Start position on genome | 317 |
End posion on genome | 391 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
acttacaaac |
tRNA gene sequence |
GCGCGGTTAGCTCAGTGGTAGAGCAACACCTTGACATGGTGGAGGTCGTAGGTTCAAATC |
Downstream region at tRNA end position |
tttttcttaa |
Secondary structure (Cloverleaf model) | >WENV182662380 Val GAC c ACCA tttttcttaa G + T C - G G - C C - G G - C G - C T - A T A T T A T C C A G A A + | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A A AGGTC A G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |