Sequence ID | >WENV182671828 |
Genome ID | OJNM01004213 |
Search identical group | |
Phylum/Class | [OJNM] metagenome; surface |
Species | |
Start position on genome | 2081 |
End posion on genome | 2156 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tccttgcctt |
tRNA gene sequence |
GCCCCCATAGCCCAATCGGCAGAGGCAGTCGACTTAAAATCGATTCAGTGTGGGTTCGAG |
Downstream region at tRNA end position |
tgtgaagtct |
Secondary structure (Cloverleaf model) | >WENV182671828 Leu TAA t ACCg tgtgaagtct G - C C - G C - G C - G C - G C - G A - T T G T C A C C C A T A A A | | | | | G C C C C G G T G G G C G | | | T T G A G G C C A G A TCAGT G + T T - A C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |