Sequence ID | >WENV182681916 |
Genome ID | OJNV01030357 |
Search identical group | |
Phylum/Class | [OJNV] human gut metagenome; human gut |
Species | |
Start position on genome | 836 |
End posion on genome | 910 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ttaagagcat |
tRNA gene sequence |
GGGGGGTTAGCTCATCTGGCTAGAGCGTAACACTGGCAGTGTTAAGGTGATCGGTTCGAG |
Downstream region at tRNA end position |
ccaattaata |
Secondary structure (Cloverleaf model) | >WENV182681916 Ala GGC t ACac ccaattaata G - C G - C G + T G - C G + T G - C T - A T G T T A G C C A C T A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTG T - A A - T A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |