Sequence ID | >W141266966 |
Genome ID | CCNF01000008 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Serratia marcescens [CCNF] |
Start position on genome | 189467 |
End posion on genome | 189392 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttctggtaat |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGCGAGTTCGAGC |
Downstream region at tRNA end position |
aatattggcc |
Secondary structure (Cloverleaf model) | >W141266966 Gly GCC t TCCA aatattggcc G - C C - G G - C G - C G - C A - T A - T C G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |