Sequence ID | >WENV182699949 |
Genome ID | OJOO01002045 |
Search identical group | |
Phylum/Class | [OJOO] human gut metagenome; human gut |
Species | |
Start position on genome | 7160 |
End posion on genome | 7234 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
actacctcat |
tRNA gene sequence |
GCAGGGATAGCTCAGTGGTAGAGCGGCTGTCTTACACACAGTTGGTCGGGGGTTCGAATC |
Downstream region at tRNA end position |
ttaataaacc |
Secondary structure (Cloverleaf model) | >WENV182699949 Val TAC t ACCA ttaataaacc G + T C - G A - T G - C G - C G - C A - T T A T C T C C C A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G TGGTC G + T C - G T - A G - C T - A C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |