Sequence ID | >WENV182715110 |
Genome ID | OJPI01000247 |
Search identical group | |
Phylum/Class | [OJPI] human gut metagenome; stool sample |
Species | |
Start position on genome | 28009 |
End posion on genome | 28083 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aactgaatat |
tRNA gene sequence |
GGCGGAATAGCTCAGTTGGCTAGAGCATACGGTTCATACCCGTAGTGTCGAGAGTTCGAA |
Downstream region at tRNA end position |
ataatccctt |
Secondary structure (Cloverleaf model) | >WENV182715110 Met CAT t ACtt ataatccctt G + T G - C C - G G - C G - C A - T A - T T A T C C C T C A T G A A | | | | G T C T C G G A G A G C G | | | | T T G G A G C C T A A GTGTC T - A A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |