Sequence ID | >WENV182722012 |
Genome ID | OJPP01018219 |
Search identical group | |
Phylum/Class | [OJPP] human gut metagenome; stool sample |
Species | |
Start position on genome | 444 |
End posion on genome | 517 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
atgcagtcat |
tRNA gene sequence |
TGGGATGTCGTCTAATGGCAGGACAGCGGATTCTGGTTCCGTCAATGGGGGTTCGACTCC |
Downstream region at tRNA end position |
ttgcatttgc |
Secondary structure (Cloverleaf model) | >WENV182722012 Gln CTG t GCCA ttgcatttgc T - A G - C G - C G - C A - T T - A G - C T C T C T C C C A A A C | + | | | G T T C T G G G G G G C G + | | | T T G G G A C C A A CAAT G + T C - G G - C G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |