Sequence ID | >WENV182727364 |
Genome ID | OJPV01015527 |
Search identical group | |
Phylum/Class | [OJPV] human gut metagenome; stool sample |
Species | |
Start position on genome | 395 |
End posion on genome | 467 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
agtttcagac |
tRNA gene sequence |
GCACCCGTAGTTCAATGGATAGAATACCGGATTCCGGTTCCGACGATATGAGTTCGATTC |
Downstream region at tRNA end position |
ttcagtaacc |
Secondary structure (Cloverleaf model) | >WENV182727364 Arg CCG c ACaa ttcagtaacc G + T C - G A - T C - G C - G C - G G - C T T T T A C T C A T A A A | | | | | G G C T T G A T G A G C G | | | + T T A G A A T T A A CGAT C A C - G G - C G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |