Sequence ID | >WENV182734853 |
Genome ID | OJQF01005723 |
Search identical group | |
Phylum/Class | [OJQF] human gut metagenome; stool sample |
Species | |
Start position on genome | 195 |
End posion on genome | 120 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gcaccatttt |
tRNA gene sequence |
GCGGGCATAGCTCATCCGGTAGAGCGCCACCTTGCCAAGGTGGAGGTAGCGAGTTCGAGT |
Downstream region at tRNA end position |
agaaatagtt |
Secondary structure (Cloverleaf model) | >WENV182734853 Gly GCC t TCCA agaaatagtt G - C C - G G - C G - C G - C C - G A - T T G T T G C T C A C T A A + | | | | G C C T C G G C G A G C G | | | | T T G G A G C T A G AGGTA C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |