Sequence ID | >WENV182736217 |
Genome ID | OJQH01000320 |
Search identical group | |
Phylum/Class | [OJQH] human gut metagenome; stool sample |
Species | |
Start position on genome | 17036 |
End posion on genome | 17111 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaacctaaaa |
tRNA gene sequence |
GTCGCGTTCGTCTAGCGGTCCAGGACTCCCGCCTTTCACGCGGGCAACACGGGTTCGAGT |
Downstream region at tRNA end position |
gctttaccgc |
Secondary structure (Cloverleaf model) | >WENV182736217 Glu TTC a GCCA gctttaccgc G + T T - A C - G G - C C - G G - C T - A T G T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C C C A T CAAC C - G C - G C - G G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |