Sequence ID | >WENV182737755 |
Genome ID | OJQI01039080 |
Search identical group | |
Phylum/Class | [OJQI] human gut metagenome; stool sample |
Species | |
Start position on genome | 187 |
End posion on genome | 103 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ctcttttcgc |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCTATCTTGAGGTGGTAGTGGGAATTCCTGTGCG |
Downstream region at tRNA end position |
tatcgaagtt |
Secondary structure (Cloverleaf model) | >WENV182737755 Leu GAG c ACCA tatcgaagtt G - C C - G C - G G - C A - T G - C G - C T G T C G C C C A T A A G | | | | | G T G G T G G C G G G C G | | | T T G A C A C T A G G TGGGAATTCCTGT C - G T - A A - T T + G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |