Sequence ID | >WENV182740603 |
Genome ID | OJQL01038975 |
Search identical group | |
Phylum/Class | [OJQL] human gut metagenome; stool sample |
Species | |
Start position on genome | 370 |
End posion on genome | 445 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aagggtaagt |
tRNA gene sequence |
GCTTGGGTAGCTCAGTTGGTAGAGCAGTAGACTTTTAATCTATTGGTCCCGGGTTCGAGT |
Downstream region at tRNA end position |
ttccctttca |
Secondary structure (Cloverleaf model) | >WENV182740603 Lys TTT t ACCA ttccctttca G + T C - G T - A T - A G - C G - C G + T T G T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A TGGTC G + T T - A A - T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |