Sequence ID | >WENV182744233 |
Genome ID | OJQR01001187 |
Search identical group | |
Phylum/Class | [OJQR] human gut metagenome; stool sample |
Species | |
Start position on genome | 10130 |
End posion on genome | 10056 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aacgatactc |
tRNA gene sequence |
GCTGGTGTGGCGCAATGGCAGCGCAACTGATTTGTAATCAGTGGGTTGCAGGTTCAACTC |
Downstream region at tRNA end position |
aaaagtccta |
Secondary structure (Cloverleaf model) | >WENV182744233 Thr TGT c TCCA aaaagtccta G - C C - G T - A G - C G - C T - A G - C T C T T G T C C A A A G + | | | | A T C G C G G C A G G C G | | | | T T G G C G C C A A GGGTT A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |