Sequence ID | >WENV182746122 |
Genome ID | OJQU01000327 |
Search identical group | |
Phylum/Class | [OJQU] human gut metagenome; stool sample |
Species | |
Start position on genome | 34619 |
End posion on genome | 34692 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
aaaacagaaa |
tRNA gene sequence |
CGGAATGTAGCGCAGTTGGTAGCGCACTACGTTCGGGACGTAGGGGTCGGGCGTTCGAGT |
Downstream region at tRNA end position |
agaacggcaa |
Secondary structure (Cloverleaf model) | >WENV182746122 Pro CGG a ACag agaacggcaa C - G G - C G - C A - T A - T T - A G - C T G T T C C G C A T G A A + | | | | G T C G C G G G G C G C G | | | | T T G G C G C T A A GGGTC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |