Sequence ID | >WENV182753368 |
Genome ID | OJRC01006464 |
Search identical group | |
Phylum/Class | [OJRC] human gut metagenome; stool sample |
Species | |
Start position on genome | 89 |
End posion on genome | 165 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tccttgcgtt |
tRNA gene sequence |
GCGGCGTTACCTCAGCTGGATAGAGGGTCTGACTACGAATCAGAACGTCACAGGTTCGAA |
Downstream region at tRNA end position |
gttgatcttc |
Secondary structure (Cloverleaf model) | >WENV182753368 Arg ACG t ACCA gttgatcttc G - C C - G G - C G - C C - G G - C T - A T A T T G T C C A C G A A | | | | | G T C T C C A C A G G C G | | | | T T G G A G G A T A G ACGTC T - A C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |