Sequence ID | >WENV182764622 |
Genome ID | OJRQ01000003 |
Search identical group | |
Phylum/Class | [OJRQ] human gut metagenome; stool sample |
Species | |
Start position on genome | 235354 |
End posion on genome | 235426 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
acatctaaat |
tRNA gene sequence |
GGTGGATTCGTCTAACGGTTAGGACACATGCCTCTCACGCATGTAATACGAGTTCGATTC |
Downstream region at tRNA end position |
aagctctcaa |
Secondary structure (Cloverleaf model) | >WENV182764622 Glu CTC t ACaa aagctctcaa G + T G - C T - A G - C G - C A - T T - A T T T T G C T C A C A A C | | | | | G G T C T G A C G A G C G + | | | T T T G G A C T A A TAAT C - G A - T T - A G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |