Sequence ID | >WENV182770705 |
Genome ID | OJRX01000593 |
Search identical group | |
Phylum/Class | [OJRX] human gut metagenome; human gut |
Species | |
Start position on genome | 36734 |
End posion on genome | 36660 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cctgccaaat |
tRNA gene sequence |
TGGGATGTGGTGTAATTGGCAACACAGCTGATTCTGGTTCAGCCATTCTTGGTTCGAGTC |
Downstream region at tRNA end position |
atgaccctcg |
Secondary structure (Cloverleaf model) | >WENV182770705 Gln CTG t GCCA atgaccctcg T - A G - C G - C G - C A - T T - A G - C T G T G G A C C A T A A G | + | | | G T T G T G C T T G G C G | | | | T T G A C A C C A A CATT G - C C - G T - A G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |