Sequence ID | >WENV182775936 |
Genome ID | OJSB01000841 |
Search identical group | |
Phylum/Class | [OJSB] human gut metagenome; human gut |
Species | |
Start position on genome | 26523 |
End posion on genome | 26449 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aattaaatat |
tRNA gene sequence |
GGCGCGTTGGTCAAGTGGTTAAGACACCGCCCTTTCACGGCGGCTTCATGGGTTCGAATC |
Downstream region at tRNA end position |
tggttattca |
Secondary structure (Cloverleaf model) | >WENV182775936 Glu TTC t ACCA tggttattca G - C G + T C - G G - C C - G G - C T - A T A T T A C C C A T G A G | | | | | G G A C T G A T G G G C G | | | T T T A G A C T A A CTTC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |