Sequence ID | >WENV182785598 |
Genome ID | OJSI01000142 |
Search identical group | |
Phylum/Class | [OJSI] human gut metagenome; human gut |
Species | |
Start position on genome | 1227 |
End posion on genome | 1143 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aatcaaaaat |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCGCTGGTCTCAAACACCAGTGGATTCACTTCCATG |
Downstream region at tRNA end position |
ataaaccctg |
Secondary structure (Cloverleaf model) | >WENV182785598 Leu CAA t ACta ataaaccctg G + T C - G C - G C - G A - T G - C A - T C T T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G G TGGATTCACTTCCAT C - G T - A G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |